How should I config the my.ini file for mysql?

Posted Jan 01, 1970 12:00 AM

Thanks for taking your time to look at my question, and I hope that you can help me with this.

I have a Windows Server 2012 server, it has:

Memory : 3840MB Ram

Processor: Intel(R) Xeon(R) CPU E5-2680 v2 @ 2.80GHz (2 CPUs), ~2.8GHz

But still mysql is going up to 100% cpu usage I ran the MySQLInstanceConfig.exe configuration Wizard to help me config everything for mysql and this is the my.ini config file that it created:

[client]

port=3306

[mysql]

default-character-set=latin1

[mysqld]

The TCP/IP Port the MySQL Server will listen on

port=3306

basedir="C:/Program Files/MySQL/MySQL Server 5.5/"

datadir="C:/ProgramData/MySQL/MySQL Server 5.5/data/"

character-set-server=latin1

default-storage-engine=INNODB

sql-mode="STRICT_TRANS_TABLES,NO_AUTO_CREATE_USER,NO_ENGINE_SUBSTITUTION"

max_connections=100

query_cache_size=0

table_cache=256

tmp_table_size=192M

thread_cache_size=8

myisam_max_sort_file_size=100G

myisam_sort_buffer_size=384M

key_buffer_size=332M

read_buffer_size=64K read_rnd_buffer_size=256K

sort_buffer_size=256K

* INNODB Specific options *

innodb_additional_mem_pool_size=14M

innodb_flush_log_at_trx_commit=1

innodb_log_buffer_size=7M

innodb_buffer_pool_size=643M

innodb_log_file_size=65M

innodb_thread_concurrency=8

But Something is still wrong, it's taking to much CPU

Tagged mysql file time

Similar Topic Questions

How should I config the my.ini file for mysql?

Thanks for taking your time to look at my question, and I hope that you can help me with this. I have a Windows Server 2012 server, it has: Memory : 3840MB Ram Processor: Intel(R) Xeon(R) CPU E5-2680 v2 @ 2.80GHz (2 CPUs),...

Posted Mar 22, 2014 9:00 AM

Can't find the my.ini file for MySQL 5.6

I'm trying to locate the my.ini file for MySQL 5.6 because I need to verify that the bind address is 0.0.0.0. When I try and find it I go to the address etc/MySQL/MySQL Server 5.6/ The only file in this address...

Posted Jan 06, 2014 1:45 AM

How should I use the proper charset for my vcard?

I had an issue with my smartphone so i needed to export my adress book check and modify each phone number. I have some contacts with spanish characters (á ñ ü) and when I try to look at my...

Posted Jan 05, 2014 3:54 AM

Python, how should I get the sequence from the xml file (xml format string)

Ucsc DAS server, which get DNA sequences by coordinate. URL: http://genome.ucsc.edu/cgi-bin/das/hg19/dna?segment=chr20:30037432,30038060 sample file: <DASDNA> <SEQUENCE id="chr20" start="30037832" stop="30038060" version="1.00"> <DNA length="229"> gtggcacccaaagatgctggaatctttatggcaaatgccgttacagatgc ...

Posted Mar 11, 2014 9:13 AM

Write a javascript program to display the details when i click the submitt button in to my mail id.how should i get the details.please help me

//write a javascript program to display the details when i click the submitt button in to my mail id.how to link one html page to another html page.how should i get the details.please help me. <HTML> ...

Posted May 19, 2014 11:01 AM

How should I handle the starting and stopping of BlueStacks from VB code?

I have a VB application that I'm using to automate tasks with BlueStacks. This requires me to be able to exit BlueStacks completely and restart it within my code. So I have two questions: Right now I'm looking looking up all BlueStacks...

Posted Nov 20, 2013 6:28 AM

Which String Matching Algorithm should I use and how should I implement the same in following scenario?

Hello all respected people, I'm working on a huge website which is Software as a service(SaaS) based. I'm mainly using PHP, MySQL, jQuery and WIRIS editor(a set of tools to create mathematical formulas) in my website. Now the scenario is my...

Posted Nov 21, 2013 1:28 AM

How do i configure the php.ini for Yahoo account>

Not sure how to set this up, my email is where it says sendmail_from . any help would be great because i haven't been able to get an email sent yet ; For Win32 only. ; http://php.net/smtp SMTP = localhost ; http://php.net/smtp-port smtp_port = 465 ;...

Posted Nov 30, 2013 6:19 AM

How should I access the <tr>in jquery?

I'm having following code snippet: <table border="0"> <tr id="24655"> <td> <a href="http://localhost/eprime/entprm/web/control/modules/questions/match_question.php?op=get_question_detail&question_ids=72224,24655,69412#searchPopContent" title="View question" class="inline_view_question_detail">QUE24655</a> <a class="c-icn c-remove delete_question" onClick="return ConfirmDelete()" title="Delete question">...

Posted Dec 06, 2013 8:40 AM

How can I target the .js HelloWorld File I made with Node.js?

I am working through "NodeBeginner.org". With extremely little command line experience I'm failing to run my first file. I've managed to run "console.log('helloworld');" from the console by entering in JUST that line. If it looks like I need to learn a more about...

Posted Dec 06, 2013 10:00 AM

How can i Go from my Html file which use Jquery mobile to my aspx file with a tag?

I have a html file which use jquery mobile to show. i want to have a button to navigate my page to another page which is ASPX. so how can i do it i use this code but it not works <a href="mngdirect.aspx" data-role="button"...

Posted Dec 08, 2013 5:46 AM

How should I write the join SQL?

I have two SQL issues I need help with. I am creating a database for a store chain. I have created an Exel-file for the store chain to fill in with following fields: firstname, lastname, email, storename, mall, town, country, storenum I...

Posted Dec 09, 2013 9:25 AM

How should I be binding my business models to my views?

Gentlemen (and mentlegen). I've come across an interesting question during my development. Right now, I use a database-agnostic unit of work layer to abstract the access of data from the actual database dependencies in my ASP MVC 4 web application. Each individual...

Posted Dec 10, 2013 6:53 AM

Where should I place the phpdoc.xml file?

Phpdoc can be configured either using a .xml file or an .ini file. The documentation is ambiguous, but it seems that using an .xml file is currently the preferred approach. Agree? Where should I place the .xml file? According to...

Posted Dec 11, 2013 10:29 AM

How should i stop the scroll viewer from scrolling depending on the position of the pointer?

I am using a rectangle in a canvas. The rectangle has a pointer_moved and pointer_exited events. These are working fine at present but when i put the canvas in a scroll panel, the pointer_moved and pointer_exited dont work because when...

Posted Dec 16, 2013 10:39 AM

Oracle SQL how should i write the following statement

I have the following logical statement: [only if table2_column1= '1'] then: If table1_column='auto' Then If table2_column2='1' Then If ...

Posted Dec 22, 2013 7:59 AM

How should i choose the appropriate web programming method? [on hold]

I searched a lot so i dont think this is a double question so please read this with your heart! i just started as a freelancer and i know PHP and CI and how to work with Wordpress and change it...

Posted Jan 01, 2014 10:53 AM

How should I store the map in a game?

I am building a simple 2D game in Java, but I cannot decide how to store the map data. I want something like arrays, however global arrays in Java are static, and they cannot be dynamic sized. I am going...

Posted Jan 02, 2014 11:01 AM

How should I ignore the сhar in URL asp.net MVC?

Please, give me an advice on the following question: there's a usual string like here : /Search/Index, and a user inputs a char accidentally: /Search/Index'. How should I ignore the сhar and make a user simply follow the link...

Posted Jan 03, 2014 7:55 AM

 
 
Email:

Username:

Password:


Register

Username:

Password:

Login


Forgot Password
Reset my password!